Share, , Google Plus, Pinterest,

Posted in:

نظرة عامة على “سر الحياة”

كما يُطلق عليه “The Secret of Life  “ .. جزء بسيط ظل غائباً عنا لفترة طويلة فلم نلتفت لأهميته إلا منذ حوالى 60 عاماً لكنه أوضح لنا الكثير من التفاصيل التى كنا نجهل 

المادة الوراثية .. الحمض النووى deoxyribonucleic acid ربما درس معظمنا عنه فى منهج الأحياء إلا أننا لم نعرف القصة بالكامل .. فأين السر ولماذا هو اكتشاف بهذه الأهمية وهل نعرف عنه كل شيء ؟

1
معظمنا يتعامل بشكل يومى مع حاسب آلى و يعرف ولو القليل عن أن كل ما نتعامل معه على هذا الجهاز من صور أو كلام أو غيره هو فى الأصل 0 و1 لغة الحاسب الآلى لا يوجد بها سوى هذين الحرفين ومنها تتشكل الأنظمة التى نتعامل معها مهما تعددت الألوان مهما تعددت الأشكال فقط حرفين .

 بحسب ما نعرف اليوم يبدو أن لغة الحياة فى الأصل تعرف فقط أربعة أحرف منها يتشكل كل شىء وهذا هو الإكتشاف !

الحمض النووى مركب يتكون من وحدات متراصة بجوار بعضها لتكون شريط له إتجاه يمكنك ان تتخيله كسهم يشير فى إتجاه معين فليكن مثلاً سهم يبدأ فى الأعلى ويشير لأسفل .. الآن تخيل سهم معاكس له ويقف بجانبه .. الآن يلتف السهمين حول بعضهم البعض ليتكون الشكل الحلزونى المميز للحمض النووى

2

 كل هذه الوحدات تتكون من سكر خماسى deoxy ribose  ويرتبط به مجموعة فوسفات و قاعدة نيتروجينية وتختلف هذه الوحدات فيما بينها فى نوع القاعدة الموجودة وللتبسيط نرمز للأنواع الأربعة بالأحرف A,T,C,G ولتتذكر أن A  يحب T و C  يحب G .

3

 الآن نعود للشكل الذى تخيلناه ولننظر عن قرب لأحد الأسهم .. تجده عبارة عن قوالب من السكر الخماسى متراصة فوق بعضها ويلصقها ببعض مجموعات الفوسفات (الأسمنت) ويبرز منها للداخل ناحية السهم الآخر القاعدة الخاصة بكل سكر خماسى لتتقابل قواعد الشريطين فى المنتصف ويترابطوا بحيث يقابل كل قاعدة من النوع A  أخرى من النوع T على الشريط المقابل وكل قاعدة من النوع C  أخرى من النوع G  وهكذا على طول الشريطين …. ألا تلاحظ الآن أنه يمكن أن يختفى أحد الشريطين من الصورة ويمكنك أن تتوقع تركيبه إذا نظرت للشريط المتبقى وترتيب القواعد عليه , يمكن لأى من الشريطين أن يعمل كقالب لإنشاء الشريط الآخر .

4

فى بداية الأمر لم يكن من المعقول أن الجزىء المسئول عن الصفات المختلفة للكائنات وعن الوراثة هو هذا الحمض النووى .. جزىء يبدو ممل “كيميائياً” يختلف فقط فى أربعة أماكن ,الوحدات المكونة له كلها متشابهة بإستثناء جزء بسيط فيها وهو القاعدة والتى تتراوح بين أربعة إحتمالات فقط  , بينما يمكن لمن يدرسون الكيمياء أن يرون مركبات أخرى كالبروتينات تتكون من حوالى 20 نوع من الأحماض الأمينية المختلفة وبعد أن تتكون تتشكل وتلتف على نفسها فيكون لها شكل مميز مركبات مميزة جداً يمكنك إن نظرت من بعيد وحاولت أن تخمن أى مركب فى الخلية يحمل المعلومات الوراثية لها أن تختار البروتينات بسهولة وأن تستبعد الحمض النووى بسهولة لكن فى الحياة لم تكن هذه هى الإجابة الصحيحة .

5

الآن يمكنك أن تتخيل شاشة الحاسب السوداء التى يظهر عليها أرقام 0 و1 باللون الأخضر وتتغير كما فى الفيلم الشهير ماتريكس تخيل فقط أن بدلاً عن فقط 0 و1 يوجد لدينا أربعة أحرف A,C,T,G

هذا هو الكود الذى يخزن معلومات الكائنات الحية هذا هو الكود الذى يتم عن طريقه نقل هذا المعلومات من الأبوين إلى الإبن لهذا شعرك أسود مثل والدك ولهذا بشرتك بهذا اللون .

فقط أسأل نفسك هذا السؤال ؟ كيف عرفوا ان القواعد تتقابل فى الداخل بين الشريطين كيف عرفوا أن السهمين يسيران فى إتجاهين مختلفين .. بل أكثر من هذا إذا كنا لا نرى هذه المركبات بأعيننا وكل الوحدات المكونة للحمض النووى متشابهة إلى حد كبير كيميائياً كيف نفصل الجزء المسئول عن لون الشعر عن الجزء المسئول عن الطول فكلهم متشابهون كيميائياً اذا كيف نقرأه كيف نعرف مثلاً أن الصفة الفلانية مسؤل عنها هذا الجزء من الحمض النووى وهو يتكون من 10,523 وحدة يسيرون بهذا التريتب CTGATTGAGATCTGATAGAAAGCT….

DNA strand with code

 أعطيك ورقة مكتوبة عليها كلام مهم وأضعك فى غرفة مظلمة بالكامل فهل تقرأ منها شىء ؟ هذا ما حدث مع هذا الكود هذا ما حدث مع هذا الجزىء …

لم نعرف عنه شىء و كان الظلام دامساً لكن تتابع العلم وتتابعت جوائز نوبل و حدث الأمر عرفنا الجزىء عرفنا مما يتكون عرفنا التسلسل الذى يسير به وبحلول عام 2003 كان عندنا تتابع الحمض النووى الخاص بالإنسان ..  (تحديداً 99% من التتابع مع بقاء أجزاء بسيطة يصعب معرفتها بالتحديد) بل وأيضا كائنات اخرى مثل الفأر وغيره

ومازال السر لم ينكشف مازلنا نجهل الكثير …

أترككم مع هذا الفيديو

ملحوظة فى الفيديو تجدون الحل كيف أستطاع الرجل أن يقرأ الورقة فى الظلام الدامس لكن إنتبهوا أيضا هذا الحل أخذ الكثير كى يتطور ويصبح بهذا الشكل :]

الامور لا تسير دائماً مثل ما نتوقع ربما لنقص علمنا أو غيره ..

بعض الحقائق التى وصلتنا أنك عزيزى القارىء يتكون الحمض النووى لك من حوالى 3.2 بليون وحدة (3,200,000,000)  بينما مثلاً الفأر حوالى2.7 بليون وحدة (2,700,000,000) في نفس الوقت الطماطم حوالى 900 مليون وحدة (900,000,000) وهذه السمكة  Protopterus aethiopicus “Marbled Lungfish “  لديها 130 بليون وحدة (130,000,000,000) (الا تجده غريباً ان هذه السمكة لديها وحدات اكثر منك !)

7

  هل لاحظت ان نتائج الإنسان التي أنقلها لك كانت فى عام 2003 يبدوا أنه مضى وقت طويل على معرفتها فماذا حدث بعد ذلك  !!

إذا أردنا التعريف فـ :

الحمض النووى : هو تتابع من وحدات تحمل كل وحدة واحدة من أربعة قواعد مختلفة

الجين : هو تتابع معين من وحدات الحمض النووى يقوم بوظيفة

الجينوم : هو المحتوى الكامل من المادة الوراثية  فى الكائن الحى

8

 هذا هو المحتوى الذى ينقله الأب لإبنه فيتشابهان فى الصفات ..ماذا يمكن أن نجد عندما نقارن المحتوى الخاص بالإنسان بغيره من الكائنات او عندما نقارن تتابع إنسان بآخر أو عندما ندقق فى تتابع إنسان معين ؟!

 هل تتخيل أن هذا هو المركب الذى يوجه الخلية .. يوجه الكائن الحى هل يصبح فأر أم  فيل فقط بتغير فى التتابع تخيل أن تكتب مثلا ACTGGTGCGA… ثم enter فترى فأر أو تكتب TTTGCTCGTC…  ثم enter فترى فيل . .. أليست هذه معضلة ممتعة ؟!

9

 لنخرج من هذا الحيز اننظر للكائنات من حولنا كل هذا الاختلاف الرائع ينتج من اختلاف فى تتابع أربعة أحرف البندا الاحمر أم الأسد الأفريقى ..ديناصور أم طاووس.. …تمساح أم نخلة .. بكتيريا أم سمك السالمون

10

 فكر فى الأسئلة التى تم طرحها فى المقال و أدرها فى عقلك :]

– ألا تجده غريباً أن هذه السمكة لديها وحدات أكثر منك !

– ماذا حدث بعد ذلك !! (2003)

– ماذا يمكن أن نجد عندما نقارن المحتوى الخاص بالإنسان بغيره من الكائنات أو عندما نقارن تتابع إنسان بآخر أو عندما ندقق فى تتابع إنسان معين ؟!

 – الحمض النووى وتنوع الكائنات ..أليست هذه معضلة ممتعة ؟!

فقط تخيل مفتاح التنوع ويا ترى إلى أين يقودنا هذا المفتاح .. عالم الإبداع

 

المصادر المستخدمة في كتابة المقال” ]1- 2- 3- 4- 5- 6- 7[

مصادر الصور 1-  2-  3-  4-  5-  6-  7-  8-  9-  10

Comments

comments

5 Comments

Leave a Reply
  1. شكرا جزيلا على المعلومات الجميلة والاسلوب السلس في نقل المعلومة
    لكن هناك معلومة خطا وهي انه تم اكتشاف 99% من تتابع البشري
    هذه المعلومة خطأ الاسف والصحيح هو تم اكتشاف 99% من تتابع كرومسوم واحد فقط وتبقى 45 واسم هذا المشروع
    لايف بمعنى الحياة
    وقد كلف العلماء منذ 1990 حتى 2003 عشرة مليارات دولار والعمل الان حاري على الكرومسوم رقم اثنان

  2. لم نسمع لك تسبحة لمن ابدع هذه الكائنات
    ام انك لك راي اخر !؟

  3. 1. المعلومة هو التي كنت اتحدث عنها هي معرفة تتابع تقريبا 99% من المادة الوراثية البشرية في Human genome project 😀
    2.سبحان الله :)

    • يا صديقي وانا بقلك المعلومة هاي غلط اعطيني مصدر معلومتك
      وانا بعطيك نشرات عليمية واوفر عليك عناء البحث
      انا بعمل دكتوراة في امريكا وتخصصي الحمض النووي

  4. من هو صاحب ومالك المشروع الحقيقي للجنوم للانسان ؟

اترك رد